Detection of Novel LAMC2 Mutations in Herlitz Junctional Epidermolysis Bullosa

Table 1 Primers for PCR amplification of the LAMC2 exon sequences from genomic DNA

Exon No.	5′-primer (L)^a	3′-primer (R)^a	Annealing Temp. (°C)	Product Size (bp)
1	ggctctcttcctgtcaggac -70	gaggtacgttcagccatcac +85	60	324
2	gacgatctcttttgtatgct -30	gttgttcccttccttcttct +96	55	315
3	gcttctaatgccgcatacat -69	ctcaaagcagtgtttggcac +114	60	319
4	gttgtgaagcatttggaagc -52	ctagttgggcaagggactct +54	55	205
5	cctgatttctacaatgccac −25	caaagccctgtacaacatta +53	55	215
6	atagatgatgagggcttgtc −50	tcctagtcctataagctggc +49	55	222
7	tcatagcccaaagtgtcata −177	aggcttgttgaacaaatgaa +102	60	469
8	ggtatgtggtaagaatcgga −51	ctacttgtttggagactgcc +93	55	255
9	ctttagactgtaccacttgc −48	gtctttcttacacagctctc +71	60	338
10	attgtctgaccctgctcact −52	cagagcagacccatggcctt +22	60	257
11	cctaggcttggtcatttgtt −30	aagtgcatacgtacacaggc +56	60	332
12	aaggattctctgctgttgga −106	acagaacacccagtggacac +72	60	321
13	gtattggatgatcccttggg −65	cctaacgtagccattccttc +68	55	290
14	ttgctaactctatgctgacc −60	tctacaagtaggtctcccaa +61	55	326
15	aatggtgaatagaggcatgg −134	aaactggtttcaaggtaggg +148	60	362
16	ctaaatcagaccagctcccg −104	ttacaactagcatggtgccc +95	60	357
17	agtcctctttttattaccgc −43	agaaagtatttatggccctc +54	55	242
18	ggtgtggtaactggtaagca −54	tattcatatggtgggcattc +60	55	267
19	gtcagagtgattttgccagc −64	caaaggaaattggtcatgac +66	55	245
20	tttgctttcatcttcacggc −44	tttccctccacaccaccctt +65	55	299
21	ctatggttgtctttgggatg −76	ataagcacaaaccagccttg +83	55	318
22	gggagatccctttcaacttg −71	tgagtgttctggagcaaagc +65	55	236
23	agttatgggtatagaagggc −86	tgacctgagcatacccatta 3821 in cDNA	55	462

^aThe numbers under each primer refer to the position of their 5′ end within the introns in relation to the intron-exon border (upstream in the case of 5′-primers and downstream in the case of 3′-primers; the numbers are according to Airenne et al., 1996 [9]; GenBank accession nos. U31178–U31201).

ISSN: 1528-3658